Review



negative control sirna targeting the sequence ttctccgaacgtgtcacgt  (Shanghai GenePharma)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Shanghai GenePharma negative control sirna targeting the sequence ttctccgaacgtgtcacgt
    Negative Control Sirna Targeting The Sequence Ttctccgaacgtgtcacgt, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/negative+control+sirna/pmc12001209-103-6-11
    Average 90 stars, based on 1 article reviews
    negative control sirna targeting the sequence ttctccgaacgtgtcacgt - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: LncRNA FAM83A-AS1 Dives ESCC Progression by Regulating miR-214/CDC25B Axis
    Article Snippet: .. 2.4 Cell transfection Three small interfering RNA sequences targeting FAM83A-AS1 and corresponding negative control sequence, along with miR-214 inhibitor and control were gained from GenePharma (Shanghai, China). ..

    Small Interfering RNA:

    Article Title: LncRNA FAM83A-AS1 Dives ESCC Progression by Regulating miR-214/CDC25B Axis
    Article Snippet: .. 2.4 Cell transfection Three small interfering RNA sequences targeting FAM83A-AS1 and corresponding negative control sequence, along with miR-214 inhibitor and control were gained from GenePharma (Shanghai, China). ..

    Negative Control:

    Article Title: LncRNA FAM83A-AS1 Dives ESCC Progression by Regulating miR-214/CDC25B Axis
    Article Snippet: .. 2.4 Cell transfection Three small interfering RNA sequences targeting FAM83A-AS1 and corresponding negative control sequence, along with miR-214 inhibitor and control were gained from GenePharma (Shanghai, China). ..

    Article Title: CD24-dependent MAPK pathway activation is required for colorectal cancer cell proliferation.
    Article Snippet: 1To whom correspondence should be addressed.. E-mail: prof.jiang@yahoo.com.cn 2Weifei Wang and Xinying Wang contributed equally to this work.. CD24 is a glycosylphosphatidylinositol-anchored membrane protein reported to be overexpressed in human tumorigenesis and progression.

    Article Title: Curcumin inhibits Ec109 cell growth via an AMPK-mediated metabolic switch.
    Article Snippet: Contents lists available at ScienceDirect Life Sciences j ourna l homepage: www.e lsev ie r .com/ locate / l i fesc ie Curcumin inhibits Ec109 cell growth via an AMPK-mediated metabolic switch Feng-Juan Zhang, Hong-Sheng Zhang ⁎, Yang Liu, Ying-Hui Huang ⁎ College of Life Science & Bioengineering, Beijing University of Technology, Pingleyuan 100#, District of Chaoyang, Beijing 100124, China ⁎ Corresponding authors.. Tel.. : +86 10 67396212 83; fa E-mail addresses: zhanghs@bjut.edu.cn (H.-S. Zhang), (Y.-H. Huang). http://dx.doi.org/10.1016/j.lfs.2015.05.016 0024-3205/© 2015 Elsevier Inc. All rights reserved. a b s t r a c t a r t i c l e i n f o Article history: Received 31 January 2015 Received in revised form 18 May 2015 Accepted 20 May 2015 Available online 31 May 2015 Keywords: Curcumin Metabolic reprogramming AMPK Glycolytic enzymes Ec109 cell Aims: Glycolytic enzymes are always greatly increased in cancer cells.

    Article Title: Inhibition of Mitochondrial Fission Preserves Photoreceptors after Retinal Detachment.
    Article Snippet: .. Small double- stranded RNAs (siRNAs) for Dynamin 1 like (DNML1) were designed and negative control sequence were purchased from GenePharma Inc. (Shanghai, China). ..

    Article Title: Inhibition of PHLPP1 ameliorates cardiac dysfunction via activation of the PI3K/Akt/mTOR signalling pathway in diabetic cardiomyopathy.
    Article Snippet: The PHLPP1 shRNA sequence was 5′-CUACCCAGUUCCAAAUUAUTT-3′ (GenePharma). .. The negative control sequence was 5′-TTCTCCGAACGTGTCACGT-3′ (GenePharma). ..

    Article Title: Annexin-1 Mediates Microglial Activation and Migration via the CK2 Pathway during Oxygen–Glucose Deprivation/Reperfusion
    Article Snippet: .. Small interfering (si) RNA duplex sequences and the negative control sequence were synthesized by Shanghai GenePharma Co., Ltd., (Shanghai, China). ..

    Sequencing:

    Article Title: LncRNA FAM83A-AS1 Dives ESCC Progression by Regulating miR-214/CDC25B Axis
    Article Snippet: .. 2.4 Cell transfection Three small interfering RNA sequences targeting FAM83A-AS1 and corresponding negative control sequence, along with miR-214 inhibitor and control were gained from GenePharma (Shanghai, China). ..

    Article Title: CD24-dependent MAPK pathway activation is required for colorectal cancer cell proliferation.
    Article Snippet: 1To whom correspondence should be addressed.. E-mail: prof.jiang@yahoo.com.cn 2Weifei Wang and Xinying Wang contributed equally to this work.. CD24 is a glycosylphosphatidylinositol-anchored membrane protein reported to be overexpressed in human tumorigenesis and progression.

    Article Title: Curcumin inhibits Ec109 cell growth via an AMPK-mediated metabolic switch.
    Article Snippet: Contents lists available at ScienceDirect Life Sciences j ourna l homepage: www.e lsev ie r .com/ locate / l i fesc ie Curcumin inhibits Ec109 cell growth via an AMPK-mediated metabolic switch Feng-Juan Zhang, Hong-Sheng Zhang ⁎, Yang Liu, Ying-Hui Huang ⁎ College of Life Science & Bioengineering, Beijing University of Technology, Pingleyuan 100#, District of Chaoyang, Beijing 100124, China ⁎ Corresponding authors.. Tel.. : +86 10 67396212 83; fa E-mail addresses: zhanghs@bjut.edu.cn (H.-S. Zhang), (Y.-H. Huang). http://dx.doi.org/10.1016/j.lfs.2015.05.016 0024-3205/© 2015 Elsevier Inc. All rights reserved. a b s t r a c t a r t i c l e i n f o Article history: Received 31 January 2015 Received in revised form 18 May 2015 Accepted 20 May 2015 Available online 31 May 2015 Keywords: Curcumin Metabolic reprogramming AMPK Glycolytic enzymes Ec109 cell Aims: Glycolytic enzymes are always greatly increased in cancer cells.

    Article Title: Inhibition of Mitochondrial Fission Preserves Photoreceptors after Retinal Detachment.
    Article Snippet: .. Small double- stranded RNAs (siRNAs) for Dynamin 1 like (DNML1) were designed and negative control sequence were purchased from GenePharma Inc. (Shanghai, China). ..

    Article Title: Inhibition of PHLPP1 ameliorates cardiac dysfunction via activation of the PI3K/Akt/mTOR signalling pathway in diabetic cardiomyopathy.
    Article Snippet: The PHLPP1 shRNA sequence was 5′-CUACCCAGUUCCAAAUUAUTT-3′ (GenePharma). .. The negative control sequence was 5′-TTCTCCGAACGTGTCACGT-3′ (GenePharma). ..

    Article Title: Annexin-1 Mediates Microglial Activation and Migration via the CK2 Pathway during Oxygen–Glucose Deprivation/Reperfusion
    Article Snippet: .. Small interfering (si) RNA duplex sequences and the negative control sequence were synthesized by Shanghai GenePharma Co., Ltd., (Shanghai, China). ..

    Control:

    Article Title: LncRNA FAM83A-AS1 Dives ESCC Progression by Regulating miR-214/CDC25B Axis
    Article Snippet: .. 2.4 Cell transfection Three small interfering RNA sequences targeting FAM83A-AS1 and corresponding negative control sequence, along with miR-214 inhibitor and control were gained from GenePharma (Shanghai, China). ..

    Article Title: Curcumin inhibits Ec109 cell growth via an AMPK-mediated metabolic switch.
    Article Snippet: Contents lists available at ScienceDirect Life Sciences j ourna l homepage: www.e lsev ie r .com/ locate / l i fesc ie Curcumin inhibits Ec109 cell growth via an AMPK-mediated metabolic switch Feng-Juan Zhang, Hong-Sheng Zhang ⁎, Yang Liu, Ying-Hui Huang ⁎ College of Life Science & Bioengineering, Beijing University of Technology, Pingleyuan 100#, District of Chaoyang, Beijing 100124, China ⁎ Corresponding authors.. Tel.. : +86 10 67396212 83; fa E-mail addresses: zhanghs@bjut.edu.cn (H.-S. Zhang), (Y.-H. Huang). http://dx.doi.org/10.1016/j.lfs.2015.05.016 0024-3205/© 2015 Elsevier Inc. All rights reserved. a b s t r a c t a r t i c l e i n f o Article history: Received 31 January 2015 Received in revised form 18 May 2015 Accepted 20 May 2015 Available online 31 May 2015 Keywords: Curcumin Metabolic reprogramming AMPK Glycolytic enzymes Ec109 cell Aims: Glycolytic enzymes are always greatly increased in cancer cells.

    Synthesized:

    Article Title: CD24-dependent MAPK pathway activation is required for colorectal cancer cell proliferation.
    Article Snippet: 1To whom correspondence should be addressed.. E-mail: prof.jiang@yahoo.com.cn 2Weifei Wang and Xinying Wang contributed equally to this work.. CD24 is a glycosylphosphatidylinositol-anchored membrane protein reported to be overexpressed in human tumorigenesis and progression.

    Article Title: Curcumin inhibits Ec109 cell growth via an AMPK-mediated metabolic switch.
    Article Snippet: Contents lists available at ScienceDirect Life Sciences j ourna l homepage: www.e lsev ie r .com/ locate / l i fesc ie Curcumin inhibits Ec109 cell growth via an AMPK-mediated metabolic switch Feng-Juan Zhang, Hong-Sheng Zhang ⁎, Yang Liu, Ying-Hui Huang ⁎ College of Life Science & Bioengineering, Beijing University of Technology, Pingleyuan 100#, District of Chaoyang, Beijing 100124, China ⁎ Corresponding authors.. Tel.. : +86 10 67396212 83; fa E-mail addresses: zhanghs@bjut.edu.cn (H.-S. Zhang), (Y.-H. Huang). http://dx.doi.org/10.1016/j.lfs.2015.05.016 0024-3205/© 2015 Elsevier Inc. All rights reserved. a b s t r a c t a r t i c l e i n f o Article history: Received 31 January 2015 Received in revised form 18 May 2015 Accepted 20 May 2015 Available online 31 May 2015 Keywords: Curcumin Metabolic reprogramming AMPK Glycolytic enzymes Ec109 cell Aims: Glycolytic enzymes are always greatly increased in cancer cells.

    Article Title: Annexin-1 Mediates Microglial Activation and Migration via the CK2 Pathway during Oxygen–Glucose Deprivation/Reperfusion
    Article Snippet: .. Small interfering (si) RNA duplex sequences and the negative control sequence were synthesized by Shanghai GenePharma Co., Ltd., (Shanghai, China). ..

    other:

    Article Title: miR-191 Inhibition Induces Apoptosis Through Reactivating Secreted Frizzled-Related Protein-1 in Cholangiocarcinoma.
    Article Snippet: A01001) and corresponding negative control (NC) sequence were all purchased from GenePharma, (Shanghai, China).

    Article Title: Suppression of MGAT3 expression and the epithelial-mesenchymal transition of lung cancer cells by miR-188-5p.
    Article Snippet: Oligonucleotide sequences for miR-188-5p mimic (forward, 50-CAUCC CUUGC AUGGU GGAGG G-3’; reverse, 50-CUCCA CCAUG CAAGG GAUGU U-30) and controlled negative control (NC) sequence (forward, 50-UUCUC CGAAC GUGUC ACGUT T-3’; reverse, 50- ACGUG ACACG UUCGG AGAATT-30) were synthesized by GenePharma (Shanghai, China).



    Similar Products

    90
    Thermo Fisher negative control sequence without 5’ overhangs
    KEY RESOURCES TABLE
    Negative Control Sequence Without 5’ Overhangs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/negative+control+sequence+without+5%E2%80%99+overhangs/pmc12210276-48-0-8
    Average 90 stars, based on 1 article reviews
    negative control sequence without 5’ overhangs - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    86
    Sangon Biotech negative control sequence
    KEY RESOURCES TABLE
    Negative Control Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/control+negative+sirna/pmc13196827-126-15-24
    Average 86 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Gene Tools Inc negative control sequence
    KEY RESOURCES TABLE
    Negative Control Sequence, supplied by Gene Tools Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/control+negative+sequence/pmc13121753-272-25-40
    Average 86 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Sangon Biotech negative control sirna sequence
    KEY RESOURCES TABLE
    Negative Control Sirna Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/control+negative+sirna/pmc12890841-88-17-26
    Average 86 stars, based on 1 article reviews
    negative control sirna sequence - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Genechem negative control oligonucleotide sequences lv nc
    KEY RESOURCES TABLE
    Negative Control Oligonucleotide Sequences Lv Nc, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/control+negative/pmc12932789-107-5-13
    Average 86 stars, based on 1 article reviews
    negative control oligonucleotide sequences lv nc - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    94
    Addgene inc negative control sequence
    KEY RESOURCES TABLE
    Negative Control Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/pEGFPC2-FmnIso1b+(Plasmid+%2319320)/pm41217685-99-8-14
    Average 94 stars, based on 1 article reviews
    negative control sequence - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    95
    MedChemExpress sirna sequences
    KEY RESOURCES TABLE
    Sirna Sequences, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/SiRNA+Negative+Control/pm40641109-104-1-45
    Average 95 stars, based on 1 article reviews
    sirna sequences - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    90
    Shanghai GenePharma negative control sirna targeting the sequence ttctccgaacgtgtcacgt
    KEY RESOURCES TABLE
    Negative Control Sirna Targeting The Sequence Ttctccgaacgtgtcacgt, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+sequence/negative+control+sirna/pmc12001209-103-6-11
    Average 90 stars, based on 1 article reviews
    negative control sirna targeting the sequence ttctccgaacgtgtcacgt - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Journal: Neuron

    Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility

    doi: 10.1016/j.neuron.2025.05.023

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , ThermoFisher , Cat # K493600.

    Techniques: Virus, Generated, Cloning, Expressing, Recombinant, Blocking Assay, Plasmid Preparation, Negative Control, Sequencing, Software